GB1839
(Plasmid
#193103)
-
PurposeGB-cassette for the expression of guide RNA targeting the DFR promoter in -376 position (gRNA2), with 2.1 Ms2 aptamer in the 3' of the scaffold.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDG3_Alpha1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGB_SynP gRNA2
-
gRNA/shRNA sequenceGCTGTATCTAATAGAATCTT
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GB1839 was a gift from Diego Orzaez (Addgene plasmid # 193103 ; http://n2t.net/addgene:193103 ; RRID:Addgene_193103) -
For your References section:
GB_SynP: A Modular dCas9-Regulated Synthetic Promoter Collection for Fine-Tuned Recombinant Gene Expression in Plants. Moreno-Gimenez E, Selma S, Calvache C, Orzaez D. ACS Synth Biol. 2022 Sep 16;11(9):3037-3048. doi: 10.1021/acssynbio.2c00238. Epub 2022 Aug 31. 10.1021/acssynbio.2c00238 PubMed 36044643