pFastBac1-OsSxph
(Plasmid
#193100)
-
PurposeProtein expression in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOophaga sylvatica saxiphilin
-
SpeciesOophaga sylvatica
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- 3C-eGFP-His10 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGTTTTCGTAACAGTTTTG
- 3′ sequencing primer CAGCTCCTCGCCCTTGCTCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1-OsSxph was a gift from Dan Minor (Addgene plasmid # 193100 ; http://n2t.net/addgene:193100 ; RRID:Addgene_193100) -
For your References section:
Definition of a saxitoxin (STX) binding code enables discovery and characterization of the anuran saxiphilin family. Chen Z, Zakrzewska S, Hajare HS, Alvarez-Buylla A, Abderemane-Ali F, Bogan M, Ramirez D, O'Connell LA, Du Bois J, Minor DL Jr. Proc Natl Acad Sci U S A. 2022 Nov;119(44):e2210114119. doi: 10.1073/pnas.2210114119. Epub 2022 Oct 24. 10.1073/pnas.2210114119 PubMed 36279441