FUW-cFos
(Plasmid
#193089)
-
Purposeconstitutive expression of mouse cFos in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUW
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecFos
-
SpeciesM. musculus (mouse)
-
GenBank ID
- Promoter Ubc
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGAAGCTCCGGTTTTGAACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-cFos was a gift from Filipe Pereira (Addgene plasmid # 193089 ; http://n2t.net/addgene:193089 ; RRID:Addgene_193089) -
For your References section:
GATA2 mitotic bookmarking is required for definitive haematopoiesis. Silverio-Alves R, Kurochkin I, Rydstrom A, Vazquez Echegaray C, Haider J, Nicholls M, Rode C, Thelaus L, Lindgren AY, Ferreira AG, Brandao R, Larsson J, de Bruijn MFTR, Martin-Gonzalez J, Pereira CF. Nat Commun. 2023 Aug 14;14(1):4645. doi: 10.1038/s41467-023-40391-x. 10.1038/s41467-023-40391-x PubMed 37580379