pADC10-SETXhel
(Plasmid #193056)

• Purpose: Baculovirus expression of human Senataxin helicase domain for protein production
• Depositing Lab: Andrew Deans
• Publication: Hodson et al Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749.

Backbone

• Vector backbone: pADC10
• Backbone size w/o insert (bp): 5807
• Total vector size (bp): 8321
• Vector type: Mammalian Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Senataxin
• Alt name: SETX, Sen1, ALS4
• Species: H. sapiens (human)
• Insert Size (bp): 2514
• Mutation: codon optimized for insect cell expression
• GenBank ID: 23064 23064
• Entrez Gene: SETX (a.k.a. ALS4, AOA2, SCAN2, SCAR1, STEX, Sen1, bA479K20.2)
• Promoter: hybrid p10 (insect) and CMV (human) expression
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGGAAACTTAAGCTTATGG
• 3′ sequencing primer: ATCCTCTAGTACTTCTCGAC

Resource Information

• Supplemental Documents:
  • pBAC_CMV_p10_senataxin helicase.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry