pFL-EGFP-3xFlag-HLTF
(Plasmid
#193055)
-
PurposeBaculovirus expression of human HLTF for recombinant protein production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFL-EGFP-3xFlag-DEST
- Backbone size w/o insert (bp) 6298
- Total vector size (bp) 9328
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHLTF
-
Alt nameZBU1; HLTF1; RNF80; HIP116; SNF2L3; HIP116A; SMARCA3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2514
-
GenBank ID6596
-
Entrez GeneHLTF (a.k.a. HIP116, HIP116A, HLTF1, RNF80, SMARCA3, SNF2L3, ZBU1)
- Promoter polyhedron
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGAAACTTAAGCTTATGG
- 3′ sequencing primer ATCCTCTAGTACTTCTCGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFL-EGFP-3xFlag-HLTF was a gift from Andrew Deans (Addgene plasmid # 193055 ; http://n2t.net/addgene:193055 ; RRID:Addgene_193055) -
For your References section:
Branchpoint translocation by fork remodelers as a general mechanism of R-loop removal. Hodson C, van Twest S, Dylewska M, O'Rourke JJ, Tan W, Murphy VJ, Walia M, Abbouche L, Nieminuszczy J, Dunn E, Bythell-Douglas R, Heierhorst J, Niedzwiedz W, Deans AJ. Cell Rep. 2022 Dec 6;41(10):111749. doi: 10.1016/j.celrep.2022.111749. 10.1016/j.celrep.2022.111749 PubMed 36476850