pTol2CG NBT:NRGIIIa:polyA
(Plasmid #193012)

• Purpose: Tol2 transgenic construct that will express human Neuregulin1 Type IIIa in neurons
• Depositing Lab: William Talbot
• Publication: Lysko et al Hum Mutat. 2022 Sep;43(9):1216-1223. doi: 10.1002/humu.24393. Epub 2022 May 17.

Backbone

• Vector backbone: pDest Tol2CG2
• Vector type: Mammalian Expression ; transposon transgenesis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: NBT
• Alt name: Xenopus neural-specific beta tubulin regulatory sequence
• Species: X. laevis (frog)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCTGGTGTCTGAAACACAGGC
• 3′ sequencing primer: ggtctgcactcagctgagtgg

Gene/Insert 2

• Gene/Insert name: NRG1 type IIIa
• Species: H. sapiens (human)
• GenBank ID: NM_001322205.2
• Entrez Gene: NRG1 (a.k.a. ARIA, GGF, GGF2, HGL, HRG, HRG1, HRGA, MST131, MSTP131, NDF, NRG1-IT2, SMDF)

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ccacaccatccactgattacacc

Resource Information

• Supplemental Documents:
  • pDestTol2CG2 NBT_nrgIIIa_polya.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry