Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTol2CG NBT:NRGIIIa:polyA
(Plasmid #193012)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193012 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDest Tol2CG2
  • Vector type
    Mammalian Expression ; transposon transgenesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    NBT
  • Alt name
    Xenopus neural-specific beta tubulin regulatory sequence
  • Species
    X. laevis (frog)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCTGGTGTCTGAAACACAGGC
  • 3′ sequencing primer ggtctgcactcagctgagtgg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NRG1 type IIIa
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001322205.2
  • Entrez Gene
    NRG1 (a.k.a. ARIA, GGF, GGF2, HGL, HRG, HRG1, HRGA, MST131, MSTP131, NDF, NRG1-IT2, SMDF)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2CG NBT:NRGIIIa:polyA was a gift from William Talbot (Addgene plasmid # 193012 ; http://n2t.net/addgene:193012 ; RRID:Addgene_193012)
  • For your References section:

    Partial loss-of-function variant in neuregulin 1 identified in family with heritable peripheral neuropathy. Lysko DE, Meireles AM, Folland C, McNamara E, Laing NG, Lamont PJ, Ravenscroft G, Talbot WS. Hum Mutat. 2022 Sep;43(9):1216-1223. doi: 10.1002/humu.24393. Epub 2022 May 17. 10.1002/humu.24393 PubMed 35485770