pJLG039
(Plasmid #192982)

• Purpose: BHR plasmid (IncP ori) expressing T7 polymerase under control of the lac promoter
• Depositing Lab: Clay Fuqua
• Publication: Greenwich et al Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16.

Backbone

• Vector backbone: pSW213
• Backbone size w/o insert (bp): 8751
• Total vector size (bp): 11370
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7 polymerase
• Species: E. coli
• Insert Size (bp): 2652
• GenBank ID: NC_012971
• Promoter: lac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TCACACAGGAAACAGCTATGAC
• 3′ sequencing primer: CGCCAGGGTTTTCCCAGTCACGAC

Resource Information

• Supplemental Documents:
  • pJLG039.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The T7 polymerase gene (1) was cloned from the chromosome of BL21(DE3).