pJLG029
(Plasmid #192980)

• Purpose: BHR plasmid (pRA301) expressing pruR-3XFLAG from T7 promoter for high yield protein purification
• Depositing Lab: Clay Fuqua
• Publication: Greenwich et al Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16.

Backbone

• Vector backbone: pRA301
• Backbone size w/o insert (bp): 6761
• Total vector size (bp): 7840
• Modifications to backbone: Bases 1410 to 905 amplified from pMAT36 (pRA301::PT7-mirA-3XFLAG) a pRA301 derivative
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pruR-3xFLAG
• Species: A. tumefaciens
• Insert Size (bp): 606
• GenBank ID: NC_003062.2
• Promoter: T7
• Tag / Fusion Protein:
  • 3XFLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pJLG029.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PruR is a periplasmic protein from Agrobacterium tumefaciens and can be used in conjunction with pJLG038 or pJLG039, which carry an inducible T7 polymerase. It can be replaced with a gene of interest for high yield protein expression from a native host.