MSCV-ASNS-OE-IRES-Thy1.1
(Plasmid
#192947)
-
PurposeAsparagine synthetase overexpression in murine cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-IRES-Thy1.1
- Backbone size w/o insert (bp) 6221
- Total vector size (bp) 7907
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersThy1.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAsparagine synthetase
-
Alt nameAsns
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1686
-
Entrez GeneAsns
- Promoter 5'LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCCTTTGTACACCCTAAGCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySusan Kaech Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453976v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-ASNS-OE-IRES-Thy1.1 was a gift from Ping-Chih Ho (Addgene plasmid # 192947 ; http://n2t.net/addgene:192947 ; RRID:Addgene_192947) -
For your References section:
CD8(+) T cell metabolic rewiring defined by scRNA-seq identifies a critical role of ASNS expression dynamics in T cell differentiation. Fernandez-Garcia J, Franco F, Parik S, Altea-Manzano P, Pane AA, Broekaert D, van Elsen J, Vermeire I, Schalley T, Planque M, van Brussel T, Schepers R, Modave E, Karakach TK, Carmeliet P, Lambrechts D, Ho PC, Fendt SM. Cell Rep. 2022 Nov 15;41(7):111639. doi: 10.1016/j.celrep.2022.111639. 10.1016/j.celrep.2022.111639 PubMed 36384124
Map uploaded by the depositor.
