pLenti-HIFR
(Plasmid
#192946)
-
PurposeLentiviral production of HIF-1alpha reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 6968
- Total vector size (bp) 12408
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIF-1alpha reporter
-
Alt nameHIFR
-
Alt namemCMV_UTR_HIF_mNeonGreen_HIF_P2A_mCerulean_PEST
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5401
- Promoter mCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACAGCAGAGATCCAGTTTG
- 3′ sequencing primer GATATCCAGCACAGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-HIFR was a gift from Markus Covert (Addgene plasmid # 192946 ; http://n2t.net/addgene:192946 ; RRID:Addgene_192946) -
For your References section:
An optimized reporter of the transcription factor hypoxia-inducible factor 1alpha reveals complex HIF-1alpha activation dynamics in single cells. Jeknic S, Kudo T, Song JJ, Covert MW. J Biol Chem. 2023 Mar 10:104599. doi: 10.1016/j.jbc.2023.104599. 10.1016/j.jbc.2023.104599 PubMed 36907438