Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-HIFR
(Plasmid #192946)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192946 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 6968
  • Total vector size (bp) 12408
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIF-1alpha reporter
  • Alt name
    HIFR
  • Alt name
    mCMV_UTR_HIF_mNeonGreen_HIF_P2A_mCerulean_PEST
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5401
  • Promoter mCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACAGCAGAGATCCAGTTTG
  • 3′ sequencing primer GATATCCAGCACAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-HIFR was a gift from Markus Covert (Addgene plasmid # 192946 ; http://n2t.net/addgene:192946 ; RRID:Addgene_192946)
  • For your References section:

    An optimized reporter of the transcription factor hypoxia-inducible factor 1alpha reveals complex HIF-1alpha activation dynamics in single cells. Jeknic S, Kudo T, Song JJ, Covert MW. J Biol Chem. 2023 Mar 10:104599. doi: 10.1016/j.jbc.2023.104599. 10.1016/j.jbc.2023.104599 PubMed 36907438