Skip to main content
Addgene

pAd-PR.Cre
(Plasmid #192936)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192936 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pAd/PL-Dest
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 34864
  • Total vector size (bp) 35583
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Trp53
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2349
  • Entrez Gene
    Trp53 (a.k.a. Tp53, bbl, bfy, bhy, p44, p53)
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
  • 3′ sequencing primer CAATGCTGGAGCCCATCACAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Rb1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2349
  • Entrez Gene
    Rb1 (a.k.a. Rb, Rb-1, p110-RB1, pRb, pp105)
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GACTTTGACCGTTTACGTGGAGA
  • 3′ sequencing primer CAATGCTGGAGCCCATCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd-PR.Cre was a gift from Thorsten Stiewe (Addgene plasmid # 192936 ; http://n2t.net/addgene:192936 ; RRID:Addgene_192936)
  • For your References section:

    Monitoring autochthonous lung tumors induced by somatic CRISPR gene editing in mice using a secreted luciferase. Merle N, Elmshauser S, Strassheimer F, Wanzel M, Konig AM, Funk J, Neumann M, Kochhan K, Helmprobst F, Pagenstecher A, Nist A, Mernberger M, Schneider A, Braun T, Borggrefe T, Savai R, Timofeev O, Stiewe T. Mol Cancer. 2022 Oct 3;21(1):191. doi: 10.1186/s12943-022-01661-2. 10.1186/s12943-022-01661-2 PubMed 36192757