pX330-FOXL2-cterm
(Plasmid
#192893)
-
PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8466
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFOXL2 C-term sgRNA
-
gRNA/shRNA sequenceCGTCTGCACCGGCATGCGGT
-
SpeciesSynthetic
-
Insert Size (bp)21
-
Entrez GeneFOXL2 (a.k.a. BPES, BPES1, PFRK, PINTO, POF3)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses Cas9 with nuclear localization signals.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-FOXL2-cterm was a gift from George Church (Addgene plasmid # 192893 ; http://n2t.net/addgene:192893 ; RRID:Addgene_192893) -
For your References section:
Directed differentiation of human iPSCs to functional ovarian granulosa-like cells via transcription factor overexpression. Pierson Smela MD, Kramme CC, Fortuna PRJ, Adams JL, Su R, Dong E, Kobayashi M, Brixi G, Kavirayuni VS, Tysinger E, Kohman RE, Shioda T, Chatterjee P, Church GM. Elife. 2023 Feb 21;12:e83291. doi: 10.7554/eLife.83291. 10.7554/eLife.83291 PubMed 36803359