pTXB1-pA-M.EcoGII
(Plasmid
#192873)
-
PurposepA-M.EcoGII expression plasmid, originally created for BIND&MODIFY method, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6745
- Total vector size (bp) 8235
-
Modifications to backboneRibosome binding site (RBS) was replaced by a canonical RBS sequence
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor pA-M.EcoGII protein expression, use T7 Express lysY competent E. coli cells (NEB C3010I). Protein expression protocol: BIND&MODIFY, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepA-M.EcoGII
-
Insert Size (bp)1490
- Promoter T7
-
Tag
/ Fusion Protein
- 3X Flag Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.08.451578v2.full.pdf for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB1-pA-M.EcoGII was a gift from Chong Tang (Addgene plasmid # 192873 ; http://n2t.net/addgene:192873 ; RRID:Addgene_192873) -
For your References section:
BIND&MODIFY: a long-range method for single-molecule mapping of chromatin modifications in eukaryotes. Weng Z, Ruan F, Chen W, Chen Z, Xie Y, Luo M, Xie Z, Zhang C, Wang J, Sun Y, Fang Y, Guo M, Tan C, Chen W, Tong Y, Li Y, Wang H, Tang C. Genome Biol. 2023 Mar 29;24(1):61. doi: 10.1186/s13059-023-02896-y. 10.1186/s13059-023-02896-y PubMed 36991510