Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPRC
(Plasmid #192855)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192855 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPRC
  • Backbone manufacturer
    Amber Bernauw, Indra Bervoets
  • Backbone size (bp) 3186
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Promoter no promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCCAGATAGCCCAGTAGCTGACATTC
  • 3′ sequencing primer GTGGTTATTCACGGTGCCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRC was a gift from Eveline Peeters (Addgene plasmid # 192855 ; http://n2t.net/addgene:192855 ; RRID:Addgene_192855)
  • For your References section:

    In Vivo Screening Method for the Identification and Characterization of Prokaryotic, Metabolite-Responsive Transcription Factors. Bernauw AJ, De Kock V, Bervoets I. Methods Mol Biol. 2022;2516:113-141. doi: 10.1007/978-1-0716-2413-5_8. 10.1007/978-1-0716-2413-5_8 PubMed 35922625