pAAV-CAG-CreiLOV-P2A-FusionRed
(Plasmid
#192818)
-
PurposeExpresses CreiLOV with FusionRed tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CAG
- Backbone size w/o insert (bp) 5515
- Total vector size (bp) 5848
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCreiLOV
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)357
- Promoter chicken β-actin promoter
-
Tag
/ Fusion Protein
- FusionRed (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KnpI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ctccgggctgtaattagcgcttggt
- 3′ sequencing primer catgtgaagccctcagggaaggact (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-CreiLOV-P2A-FusionRed was a gift from Kiryl Piatkevich (Addgene plasmid # 192818 ; http://n2t.net/addgene:192818 ; RRID:Addgene_192818) -
For your References section:
Enhanced small green fluorescent proteins as a multisensing platform for biosensor development. Liang GT, Lai C, Yue Z, Zhang H, Li D, Chen Z, Lu X, Tao L, Subach FV, Piatkevich KD. Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022. 10.3389/fbioe.2022.1039317 PubMed 36324888