pAAV-FLEX-SaCas9-U6-sgKcnab2
(Plasmid
#192795)
-
PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcnab2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX601
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgKcnab2
-
gRNA/shRNA sequenceGAATCTGGGCAAATCTGGCCT
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-FLEX-SaCas9-U6-sgKcnab2 was a gift from Marta Soden (Addgene plasmid # 192795 ; http://n2t.net/addgene:192795 ; RRID:Addgene_192795) -
For your References section:
The potassium channel auxiliary subunit Kvbeta2 (Kcnab2) regulates Kv1 channels and dopamine neuron firing. Yee JX, Rastani A, Soden ME. J Neurophysiol. 2022 Jul 1;128(1):62-72. doi: 10.1152/jn.00194.2022. Epub 2022 Jun 15. 10.1152/jn.00194.2022 PubMed 35788155