pCAG-G-Flamp2-mut
(Plasmid #192783)

• Purpose: control probe of G-Flamp2, insensitive to cAMP
• Depositing Lab: Jun Chu
• Publication: Liu et al Front Pharmacol. 2022 May 12;13:902290. doi: 10.3389/fphar.2022.902290. eCollection 2022.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 6342
• Total vector size (bp): 7608
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G-Flamp2-mut
• Species: Synthetic
• Insert Size (bp): 1266
• Promoter: CAG
• Tag / Fusion Protein:
  • His tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pCAG-G-Flamp2-mut (for Addgene).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry