pDONR221-kcnj6
(Plasmid
#192725)
-
PurposeGateway entry vector encoding zebrafish kcnj6
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR221
-
Backbone manufacturerInvitrogen
-
Vector typeGateway Entry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namekcnj6
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1257
-
Mutation5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6
-
Entrez Genekcnj6
- Promoter None
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 forward
- 3′ sequencing primer M13 reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
cDNA encodes homolog of human KCNJ6
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR221-kcnj6 was a gift from Summer Thyme (Addgene plasmid # 192725 ; http://n2t.net/addgene:192725 ; RRID:Addgene_192725)