pCK760
(Plasmid #192643)

• Purpose: Expresses BBa_J23110-sfGFP (capacity monitor) and J3-Bba_J23117-mRFP (CRISPRa reporter) on pSC101-AmpR
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405.

Backbone

• Vector backbone: pJF143.J3 (Addgene #153028)
• Backbone manufacturer: Jesse Zalatan
• Backbone size w/o insert (bp): 3368
• Total vector size (bp): 5546
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BBa_J23110-sfGFP
• Species: Synthetic
• Insert Size (bp): 1108
• Promoter: BBa_J23110

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTAGAAAAATAAACAAATAGGGGTTCCGCGC
• 3′ sequencing primer: ACAGGATGTCCCAAGCGAAC

Resource Information

• Supplemental Documents:
  • pCK760.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is low copy and therefore has a higher percentage of E. coli genomic DNA. To get high concentration / high purity plasmid of pSC101 backbone, we usually grow multiple cultures and pool them into one column for miniprep. For Qiagen miniprep kit, we included PB wash step to increase the purity.