pCK760
(Plasmid
#192643)
-
PurposeExpresses BBa_J23110-sfGFP (capacity monitor) and J3-Bba_J23117-mRFP (CRISPRa reporter) on pSC101-AmpR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJF143.J3 (Addgene #153028)
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 3368
- Total vector size (bp) 5546
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBBa_J23110-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1108
- Promoter BBa_J23110
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTAGAAAAATAAACAAATAGGGGTTCCGCGC
- 3′ sequencing primer ACAGGATGTCCCAAGCGAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is low copy and therefore has a higher percentage of E. coli genomic DNA. To get high concentration / high purity plasmid of pSC101 backbone, we usually grow multiple cultures and pool them into one column for miniprep. For Qiagen miniprep kit, we included PB wash step to increase the purity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK760 was a gift from Jesse Zalatan (Addgene plasmid # 192643 ; http://n2t.net/addgene:192643 ; RRID:Addgene_192643) -
For your References section:
Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874