pCK364.306
(Plasmid
#192642)
-
PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) and scRNA J306 on p15A-CmR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCK341 (Addgene #192640)
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 1726
- Total vector size (bp) 8073
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameJ306 scRNA
-
Alt nameTTGTGTCCAGAACGCTCCGT
-
SpeciesSynthetic
-
Insert Size (bp)731
- Promoter BBa_J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caagagattacgcgcagacc
- 3′ sequencing primer ctggatttgttcagaacgctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK364.306 was a gift from Jesse Zalatan (Addgene plasmid # 192642 ; http://n2t.net/addgene:192642 ; RRID:Addgene_192642) -
For your References section:
Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874