pHR-PGK-LexA-CIB1-biLINuS-P2A-tagBFP
(Plasmid
#192609)
-
PurposeLentiviral vector for constitutive expression of LexA-CIB1-biLINuS-P2A-tagBFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexA-CIB1-biLINuS-P2A-tagBFP
- Promoter PGK
-
Tag
/ Fusion Protein
- tagBFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cacgtctgccgcgctgttctc
- 3′ sequencing primer gatatcaagcttgcatgcctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-PGK-LexA-CIB1-biLINuS-P2A-tagBFP was a gift from Yingxiao Wang (Addgene plasmid # 192609 ; http://n2t.net/addgene:192609 ; RRID:Addgene_192609) -
For your References section:
Engineering light-controllable CAR T cells for cancer immunotherapy. Huang Z, Wu Y, Allen ME, Pan Y, Kyriakakis P, Lu S, Chang YJ, Wang X, Chien S, Wang Y. Sci Adv. 2020 Feb 19;6(8):eaay9209. doi: 10.1126/sciadv.aay9209. eCollection 2020 Feb. 10.1126/sciadv.aay9209 PubMed 32128416