pOttc1473 - pAAV CaMKII KDELR2-Myc-DDK
(Plasmid
#192600)
-
PurposeAn AAV packaging vector that expresses KDELR2 under control of the CaMKII promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOTTC1470 - pAAV CaMKII iRFP-FLAG
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 5415
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDELR2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)732
-
Entrez GeneKDELR2 (a.k.a. ELP-1, ELP1, ERD2.2, OI21)
- Promoter CaMKII
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CaMKII-Forward CGTCAGTCAAGCCGGTTCTC
- 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNIDA GEVVC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOttc1473 - pAAV CaMKII KDELR2-Myc-DDK was a gift from Brandon Harvey (Addgene plasmid # 192600 ; http://n2t.net/addgene:192600 ; RRID:Addgene_192600)