pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA
(Plasmid #192552)

• Purpose: Expresses nuclear localized tdTomato under CAG promoter
• Depositing Lab: Guoping Feng
• Publication: Feng Lab AAV plasmid (unpublished)

Backbone

• Vector backbone: N/A
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 5200
• Total vector size (bp): 6600
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tdTomato
• Alt name: tdT
• Species: Synthetic
• Insert Size (bp): 1422
• Mutation: deleted E273 and G274 compared to FPbase ID: PGG5S
• Promoter: CAG
• Tag / Fusion Protein:
  • NLS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctgtccgcggggggacggc
• 3′ sequencing primer: tcctcataaagagacagcaacc

Resource Information

• Supplemental Documents:
  • pAAV-CAG-2xNLS-tdTomato-c3_01.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene Verified sequence contains ambiguous bases due to the GC-rich CAG promoter region.

Information for AAV9 (Catalog # 192552-AAV9)

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (#192552). In addition to the viral particles, you will also receive purified pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA plasmid DNA.

CAG-driven expression of nuclear localized tdTomato. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV PHP.eB (Catalog # 192552-PHPeB)

Purpose

Ready-to-use AAV PHP.eB particles produced from pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (#192552). In addition to the viral particles, you will also receive purified pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA plasmid DNA.

CAG-driven expression of nuclear localized tdTomato. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
  pUCmini-iCAP-PHP.eB (plasmid #103005)
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: PHPeB (plasmid #103005)
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and Benjamin Deverman and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.