pOPINF Ta-sro1 PARP
(Plasmid
#192549)
-
PurposeE. coli expression vector for Triticum aestivum sro1 PARP domain (amino acids 246-434)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOPINF
-
Backbone manufacturerBerrow et al. (2007) PMID 17317681
- Backbone size w/o insert (bp) 5142
- Total vector size (bp) 5769
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSIMILAR TO RCD ONE 1 (SRO1) PARP domain, cultivar Shanrong No. 3 (SR3)
-
Alt nameTa-sro1
-
Alt namePARP fragment
-
Alt namepoly(ADP-ribose) polymerase
-
SpeciesTriticum aestivum
-
Insert Size (bp)627
-
GenBank IDAEK94072
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His6, 3C protease cleavage site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CACCACCTTCTGATAGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bygene synthesis based on sequence information from Liu et al. 2004, PMID 24443520
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINF Ta-sro1 PARP was a gift from Lennart Wirthmueller (Addgene plasmid # 192549 ; http://n2t.net/addgene:192549 ; RRID:Addgene_192549) -
For your References section:
The superior salinity tolerance of bread wheat cultivar Shanrong No. 3 is unlikely to be caused by elevated Ta-sro1 poly-(ADP-ribose) polymerase activity. Vogt S, Feijs K, Hosch S, De Masi R, Lintermann R, Loll B, Wirthmueller L. Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261. 10.1093/plcell/koac261 PubMed 35980152