pENTR4 PARP2 E614Q
(Plasmid
#192545)
-
PurposepENTR plasmid Arabidopsis thaliana PARP2 CDS, E614Q mutation, no stop codon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR4
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 2235
- Total vector size (bp) 4146
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepoly(ADP-ribose) polymerase 2 E614Q
-
Alt namePARP2
-
Alt nameAT4G02390
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1911
-
Mutationchanged Glu 614 to Gln
-
Entrez GeneAT3G18250 (a.k.a. AT3G18250)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCGCCATAAACTGCCAGG
- 3′ sequencing primer CGTTGAATATGGCTCATAACACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR4 PARP2 E614Q was a gift from Lennart Wirthmueller (Addgene plasmid # 192545 ; http://n2t.net/addgene:192545 ; RRID:Addgene_192545) -
For your References section:
The superior salinity tolerance of bread wheat cultivar Shanrong No. 3 is unlikely to be caused by elevated Ta-sro1 poly-(ADP-ribose) polymerase activity. Vogt S, Feijs K, Hosch S, De Masi R, Lintermann R, Loll B, Wirthmueller L. Plant Cell. 2022 Aug 18. pii: 6671231. doi: 10.1093/plcell/koac261. 10.1093/plcell/koac261 PubMed 35980152