TL021_lenti_CMV:SEP-GluA1
(Plasmid
#192515)
-
PurposeExpression of AMPA GluA1 with N terminal super ecliptic phluorin (SEP) fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFCMV
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 12060
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSEP-GluA1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3519
- Promoter CMV
-
Tag
/ Fusion Protein
- super ecliptic phluorin (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TL021_lenti_CMV:SEP-GluA1 was a gift from Adam Cohen (Addgene plasmid # 192515 ; http://n2t.net/addgene:192515 ; RRID:Addgene_192515) -
For your References section:
Mapping memories: pulse-chase labeling reveals AMPA receptor dynamics during memory formation. Kim D, Park P, Li X, Wong Campos JD, Tian H, Moult EM, Grimm JB, Lavis L, Cohen AE. bioRxiv. 2023 May 29:2023.05.26.541296. doi: 10.1101/2023.05.26.541296. Preprint. 10.1101/2023.05.26.541296 PubMed 37292614