Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiGuideFB-Puro-B
(Plasmid #192507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192507 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bU6-sgRNACR2-CS-BsmBI-EFS-Puro-WPRE
  • Species
    H. sapiens (human), B. taurus (bovine), Synthetic
  • Promoter bU6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcagagatccagtttggt
  • 3′ sequencing primer gcattaaagcagcgtatccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuideFB-Puro-B was a gift from Neville Sanjana (Addgene plasmid # 192507 ; http://n2t.net/addgene:192507 ; RRID:Addgene_192507)
  • For your References section:

    Efficient combinatorial targeting of RNA transcripts in single cells with Cas13 RNA Perturb-seq. Wessels HH, Mendez-Mancilla A, Hao Y, Papalexi E, Mauck WM 3rd, Lu L, Morris JA, Mimitou EP, Smibert P, Sanjana NE, Satija R. Nat Methods. 2023 Jan;20(1):86-94. doi: 10.1038/s41592-022-01705-x. Epub 2022 Dec 22. 10.1038/s41592-022-01705-x PubMed 36550277