pLVX_DSB_Spectrum-V2
(Plasmid
#192475)
-
PurposeLentiviral DSB Spectrum V2 Reporter System
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVX
- Total vector size (bp) 11006
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP1.2, incompleteGFP
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX_DSB_Spectrum-V2 was a gift from Michael Yaffe (Addgene plasmid # 192475 ; http://n2t.net/addgene:192475 ; RRID:Addgene_192475) -
For your References section:
Multi-pathway DNA-repair reporters reveal competition between end-joining, single-strand annealing and homologous recombination at Cas9-induced DNA double-strand breaks. van de Kooij B, Kruswick A, van Attikum H, Yaffe MB. Nat Commun. 2022 Sep 8;13(1):5295. doi: 10.1038/s41467-022-32743-w. 10.1038/s41467-022-32743-w PubMed 36075911