pBAD-bARGSer-AxeTxe
(Plasmid
#192473)
-
PurposeSecond-generation bacterial acoustic reporter gene derived from Serratia
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD33
-
Backbone manufacturerBeckwith Lab
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 23202
-
Modifications to backbonepoint mutations introduced during cloning
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namebARGSer
-
Alt nameBacterial acoustic reporter genes originating from Serratia sp. ATCC 39006
-
Alt nameModified gas vesicle gene cluster from Serratia sp. ATCC 39006
-
SpeciesSerratia sp. ATCC 39006
-
Insert Size (bp)16692
-
Mutationthe gene Ser39006_001280 was deleted from the cluster, and 3 point mutations were introduced during cloning (GvpG P133P, GvpW P609H, GvpZ D112Y)
-
GenBank IDAWXH00000000.1 AWXH00000000.1
- Promoter pBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAATTGTCCATATTGCATC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAxeTxe
-
Alt nameToxin-antitoxin system
-
SpeciesEnterococcus faecium
-
Insert Size (bp)1212
-
GenBank IDAF507977.1 AF507977.1
- Promoter Native promoter from Enterococcus faecium
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTAATGAGGATGCTGAAACAC
- 3′ sequencing primer AAGCATCATCAGACCAAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2021.04.26.441537v3 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-bARGSer-AxeTxe was a gift from Mikhail Shapiro (Addgene plasmid # 192473 ; http://n2t.net/addgene:192473 ; RRID:Addgene_192473) -
For your References section:
Genomically mined acoustic reporter genes for real-time in vivo monitoring of tumors and tumor-homing bacteria. Hurt RC, Buss MT, Duan M, Wong K, You MY, Sawyer DP, Swift MB, Dutka P, Barturen-Larrea P, Mittelstein DR, Jin Z, Abedi MH, Farhadi A, Deshpande R, Shapiro MG. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01581-y. 10.1038/s41587-022-01581-y PubMed 36593411