Skip to main content
Addgene

pBAD-bARGSer-AxeTxe
(Plasmid #192473)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192473 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBAD33
  • Backbone manufacturer
    Beckwith Lab
  • Backbone size w/o insert (bp) 5352
  • Total vector size (bp) 23202
  • Modifications to backbone
    point mutations introduced during cloning
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    bARGSer
  • Alt name
    Bacterial acoustic reporter genes originating from Serratia sp. ATCC 39006
  • Alt name
    Modified gas vesicle gene cluster from Serratia sp. ATCC 39006
  • Species
    Serratia sp. ATCC 39006
  • Insert Size (bp)
    16692
  • Mutation
    the gene Ser39006_001280 was deleted from the cluster, and 3 point mutations were introduced during cloning (GvpG P133P, GvpW P609H, GvpZ D112Y)
  • GenBank ID
    AWXH00000000.1 AWXH00000000.1
  • Promoter pBAD

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCAATTGTCCATATTGCATC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AxeTxe
  • Alt name
    Toxin-antitoxin system
  • Species
    Enterococcus faecium
  • Insert Size (bp)
    1212
  • GenBank ID
    AF507977.1 AF507977.1
  • Promoter Native promoter from Enterococcus faecium

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTAATGAGGATGCTGAAACAC
  • 3′ sequencing primer AAGCATCATCAGACCAAGCC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-bARGSer-AxeTxe was a gift from Mikhail Shapiro (Addgene plasmid # 192473 ; http://n2t.net/addgene:192473 ; RRID:Addgene_192473)

  • For your References section:

    Genomically mined acoustic reporter genes for real-time in vivo monitoring of tumors and tumor-homing bacteria. Hurt RC, Buss MT, Duan M, Wong K, You MY, Sawyer DP, Swift MB, Dutka P, Barturen-Larrea P, Mittelstein DR, Jin Z, Abedi MH, Farhadi A, Deshpande R, Shapiro MG. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01581-y. 10.1038/s41587-022-01581-y PubMed 36593411
Related items:
Commonly requested with: