betaTrCP mVenus reporter
(Plasmid
#192458)
-
PurposeFluorescent reporter for beta-TrCP activity in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
-
Backbone manufacturern/a
- Backbone size w/o insert (bp) 8765
- Total vector size (bp) 9971
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDC25B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1206
-
Mutationaa198-338
-
GenBank IDNM_021873.4
-
Entrez GeneCDC25B
- Promoter EF1alpha
-
Tags
/ Fusion Proteins
- mVenus (C terminal on insert)
- SV40 NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcaggtgtcgtgaggatcc
- 3′ sequencing primer agagcggccgccctcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
betaTrCP mVenus reporter was a gift from Steven Cappell (Addgene plasmid # 192458 ; http://n2t.net/addgene:192458 ; RRID:Addgene_192458) -
For your References section:
Revealing beta-TrCP activity dynamics in live cells with a genetically encoded biosensor. Paul D, Kales SC, Cornwell JA, Afifi MM, Rai G, Zakharov A, Simeonov A, Cappell SD. Nat Commun. 2022 Oct 26;13(1):6364. doi: 10.1038/s41467-022-33762-3. 10.1038/s41467-022-33762-3 PubMed 36289220