pSEVA351-Cpf1
(Plasmid #192361)

• Purpose: CRISPR-based vector for genome editing
• Depositing Lab: Juana María Navarro Llorens
• Publication: Baldanta et al Microb Cell Fact. 2022 May 28;21(1):103. doi: 10.1186/s12934-022-01830-4.

Backbone

• Vector backbone: pSEVA351
• Backbone manufacturer: SEVA collection
• Backbone size w/o insert (bp): 5120
• Total vector size (bp): 9859
• Modifications to backbone: Insertion of a CRISPR-Cas12 cassette
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas12a, gRNA scaffold
• Alt name: Cpf1
• Species: Francisella novicida
• Insert Size (bp): 4757

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: gGATCCtcgatgtaacccactcgtgc
• 3′ sequencing primer: agttggtaccgtcgacctgca

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ungerer, J., & Pakrasi, H. B. (2016). Cpf1 is a versatile tool for CRISPR genome editing across diverse species of cyanobacteria. Scientific reports, 6(1), 1-9.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CRISPR cassette form the vector pSL2680