Skip to main content
Addgene

pAAV-ADP-MCS-FLAG
(Plasmid #192360)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192360 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Backbone size (bp) 4028
  • Modifications to backbone
    Adiponectin promoter-MCS-3xFlag
  • Vector type
    Mammalian Expression, AAV
  • Promoter adiponectin promoter
  • Tag / Fusion Protein
    • 3xflag (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ttgctctctgcagcagtgtg
  • 3′ sequencing primer agcagcgtatccacatagcg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-ADP-MCS-FLAG was a gift from Yifu Qiu (Addgene plasmid # 192360 ; http://n2t.net/addgene:192360 ; RRID:Addgene_192360)

  • For your References section:

    The mitochondrial calcium uniporter engages UCP1 to form a thermoporter that promotes thermogenesis. Xue K, Wu D, Wang Y, Zhao Y, Shen H, Yao J, Huang X, Li X, Zhou Z, Wang Z, Qiu Y. Cell Metab. 2022 Sep 6;34(9):1325-1341.e6. doi: 10.1016/j.cmet.2022.07.011. Epub 2022 Aug 16. 10.1016/j.cmet.2022.07.011 PubMed 35977541
Related items:
Commonly requested with: