pDEST_5xUAS:EB3-mScarlet-I
(Plasmid #192358)

• Purpose: EB3 tagged with mScarlet-I, expressed under the UAS promoter
• Depositing Lab: Francesca Peri
• Publication: Moller et al Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094.

Backbone

• Vector backbone: Gateway Tol2 destination vector with zebrafish aA-crystallin promoter driving CFP in lens
• Total vector size (bp): 8129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EB3
• Alt name: MAPRE3
• Species: H. sapiens (human)
• Insert Size (bp): 843
• GenBank ID: 22924
• Entrez Gene: MAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
• Tag / Fusion Protein:
  • mScarlet-I (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtctgaaacacaggccagat
• 3′ sequencing primer: CCACATTTGTAGAGGTTTTACTTGC

Resource Information

• Supplemental Documents:
  • pdest_cryecfp_5xuaseb3-mscarlett-i.gb
• A portion of this plasmid was derived from a plasmid made by: The EB3 cDNA was given by the Gilmour lab (Revenu et al. 2014), but was originally cloned by Stepanova et al. 2003.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.