pDEST_6xUAS:Lamp1-mGFP
(Plasmid #192356)

• Purpose: Lamp1 tagged with mGFP, expressed under the UAS promoter
• Depositing Lab: Francesca Peri
• Publication: Moller et al Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094.

Backbone

• Vector backbone: Gateway Tol2 destination vector with cmlc2:mRFP-SV40pA for zebrafish red heart transgenesis marker
• Total vector size (bp): 8540
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lamp1
• Alt name: CD107a, LAMPA, LGP120
• Species: H. sapiens (human)
• GenBank ID: 3916
• Entrez Gene: LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
• Tag / Fusion Protein:
  • mGFP (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtctgaaacacaggccagat
• 3′ sequencing primer: CCACATTTGTAGAGGTTTTACTTGC

Resource Information

• Supplemental Documents:
  • pdesttol2cg2rbh_cmlc2tagrfp_lamp1-mgfp.gb
• A portion of this plasmid was derived from a plasmid made by: Insert was cloned from Lamp1-mGFP, a gift from Esteban Dell‘Angelica (Addgene plasmid #34831; Falcón-Pérez et al., 2005).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.