pDEST_6xUAS:mNeonGreen-Rab5a
(Plasmid #192355)

• Purpose: zfRabaa tagged with mNeonGreen, expressed under the UAS promoter
• Depositing Lab: Francesca Peri
• Publication: Moller et al Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094.

Backbone

• Vector backbone: Gateway Tol2 destination vector with cmlc2:mRFP-SV40pA for zebrafish red heart transgenesis marker
• Total vector size (bp): 7630
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab5a
• Species: D. rerio (zebrafish)
• Insert Size (bp): 651
• GenBank ID: 337737
• Entrez Gene: rab5aa (a.k.a. fj38g08, hm:zehn1144, rab5a, wu:fj38g08)
• Tag / Fusion Protein:
  • mNeonGreen (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtctgaaacacaggccagat
• 3′ sequencing primer: CCACATTTGTAGAGGTTTTACTTGC

Resource Information

• Supplemental Documents:
  • pdest_tol2-cg2rbh_6xuasmneongreen-rab5a.gb
• A portion of this plasmid was derived from a plasmid made by: The Rab5aa cDNA was a gift from the Gilmour lab, originally published in Hartmann et al., 2020.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • mNeonGreen Label License
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.