Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAGT5439
(Plasmid #192351)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192351 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAGM9121
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 2073
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TTCG_Stop-tOCS_CGCT
  • Insert Size (bp)
    729

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
  • 3′ sequencing primer GCCGTTACCACCGCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT5439 was a gift from Tom Schreiber (Addgene plasmid # 192351 ; http://n2t.net/addgene:192351 ; RRID:Addgene_192351)
  • For your References section:

    Enhancing gene editing and gene targeting efficiencies in Arabidopsis thaliana by using an intron-containing version of ttLbCas12a. Schindele P, Merker L, Schreiber T, Prange A, Tissier A, Puchta H. Plant Biotechnol J. 2023 Mar;21(3):457-459. doi: 10.1111/pbi.13964. Epub 2022 Nov 30. 10.1111/pbi.13964 PubMed 36382936