Skip to main content
Addgene

tet pLKO.1-shNUP37 v1 puro
(Plasmid #192343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192343 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    tet pLKO.1 puro
  • Backbone manufacturer
    Addgene #21915
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shNUP37 v1
  • gRNA/shRNA sequence
    CATTGCCTCCAGTAATCAAAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    NUP37 (a.k.a. MCPH24, p37)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet pLKO.1-shNUP37 v1 puro was a gift from Kevin Janes (Addgene plasmid # 192343 ; http://n2t.net/addgene:192343 ; RRID:Addgene_192343)
  • For your References section:

    Nucleocytoplasmic transport of active HER2 causes fractional escape from the DCIS-like state. Wang L, Paudel BB, McKnight RA, Janes KA. Nat Commun. 2023 Apr 13;14(1):2110. doi: 10.1038/s41467-023-37914-x. 10.1038/s41467-023-37914-x PubMed 37055441