TERTp124_Gluc_CCR5
(Plasmid
#192271)
-
PurposeDonor template for insertion of hTERT promoter (-124 C to T) driven Gaussia luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAY10_pS.Donor.R5.TS
-
Backbone manufacturerManuel A.F.V. Goncalves
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter Reporter Insert within donor template
-
Alt nameGaussia luciferase reporter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1309
-
Mutation-124 C to T
- Promoter TERT promoter driving expression of gaussia
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TTTTGGCAGGGCTCCGATGTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TERTp124_Gluc_CCR5 was a gift from Shantanu Chowdhury (Addgene plasmid # 192271 ; http://n2t.net/addgene:192271 ; RRID:Addgene_192271) -
For your References section:
Human telomerase is directly regulated by non-telomeric TRF2-G-quadruplex interaction. Sharma S, Mukherjee AK, Roy SS, Bagri S, Lier S, Verma M, Sengupta A, Kumar M, Nesse G, Pandey DP, Chowdhury S. Cell Rep. 2021 May 18;35(7):109154. doi: 10.1016/j.celrep.2021.109154. 10.1016/j.celrep.2021.109154 PubMed 34010660