pET-15b(ETNPPL)
(Plasmid #192264)

• Purpose: Coding sequence of mouse ETNPPL is inserted in pET-15b vector
• Depositing Lab: Toshihide Yamashita
• Publication: Tsujioka et al Front Cell Neurosci. 2023 Jan 30;17:1097512. doi: 10.3389/fncel.2023.1097512. eCollection 2023.

Backbone

• Vector backbone: pET-15b
• Backbone manufacturer: Millipore
• Backbone size w/o insert (bp): 5710
• Total vector size (bp): 7210
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ethanolamine phosphate phospholyase
• Alt name: Etnppl
• Alt name: Agxt2l1
• Species: M. musculus (mouse)
• Insert Size (bp): 1500
• GenBank ID: NM_027907.3
• Entrez Gene: Etnppl (a.k.a. 1300019H02Rik, Agxt2l1)
• Tag / Fusion Protein:
  • His-tag (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taagcatggtcaagggtgat
• 3′ sequencing primer: gccatggactccaagagtgg

Resource Information

• Supplemental Documents:
  • pET-15b(ETNPPL).ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry