Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-15b(ETNPPL)
(Plasmid #192264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-15b
  • Backbone manufacturer
    Millipore
  • Backbone size w/o insert (bp) 5710
  • Total vector size (bp) 7210
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ethanolamine phosphate phospholyase
  • Alt name
    Etnppl
  • Alt name
    Agxt2l1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1500
  • GenBank ID
    NM_027907.3
  • Entrez Gene
    Etnppl (a.k.a. 1300019H02Rik, Agxt2l1)
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taagcatggtcaagggtgat
  • 3′ sequencing primer gccatggactccaagagtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-15b(ETNPPL) was a gift from Toshihide Yamashita (Addgene plasmid # 192264 ; http://n2t.net/addgene:192264 ; RRID:Addgene_192264)
  • For your References section:

    Utilization of ethanolamine phosphate phospholyase as a unique astrocytic marker. Tsujioka H, Yamashita T. Front Cell Neurosci. 2023 Jan 30;17:1097512. doi: 10.3389/fncel.2023.1097512. eCollection 2023. 10.3389/fncel.2023.1097512 PubMed 36794261