Skip to main content
Addgene

eIF3b sgRNA-1 PX459 plasmid
(Plasmid #192249)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192249 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Px459VQR(Plasmid #101717)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-1 targeting eIF3b locus closed to stop coden
  • gRNA/shRNA sequence
    GACAGCAACGTGGACGACTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    EIF3B (a.k.a. EIF3-ETA, EIF3-P110, EIF3-P116, EIF3S9, PRT1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer hU6-F_GAGGGCCTATTTCCCATGATT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eIF3b sgRNA-1 PX459 plasmid was a gift from Dieter Wolf (Addgene plasmid # 192249 ; http://n2t.net/addgene:192249 ; RRID:Addgene_192249)

  • For your References section:

    eIF3 mRNA selectivity profiling reveals eIF3k as a cancer-relevant regulator of ribosome content. Duan H, Zhang S, Zarai Y, Ollinger R, Wu Y, Sun L, Hu C, He Y, Tian G, Rad R, Kong X, Cheng Y, Tuller T, Wolf DA. EMBO J. 2023 Jun 15;42(12):e112362. doi: 10.15252/embj.2022112362. Epub 2023 May 8. 10.15252/embj.2022112362 PubMed 37155573
Related items: