Skip to main content
Addgene

pCDH-CMV-RPS4X-3xHA plasmid
(Plasmid #192246)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192246 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-puro-3XFLAG-3XHA(XbaI_NotI)
  • Backbone manufacturer
    generously provided by L. Wen (Xiamen University)
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPS4X CDS without stop coden
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    789
  • Entrez Gene
    RPS4X (a.k.a. CCG2, DXS306, RPS4, S4, SCAR, SCR10, eS4)
  • Tag / Fusion Protein
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CMV-F_CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ACC TTC TCT AGG CAC CCG TTC AAT TGC CGA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-CMV-RPS4X-3xHA plasmid was a gift from Dieter Wolf (Addgene plasmid # 192246 ; http://n2t.net/addgene:192246 ; RRID:Addgene_192246)

  • For your References section:

    eIF3 mRNA selectivity profiling reveals eIF3k as a cancer-relevant regulator of ribosome content. Duan H, Zhang S, Zarai Y, Ollinger R, Wu Y, Sun L, Hu C, He Y, Tian G, Rad R, Kong X, Cheng Y, Tuller T, Wolf DA. EMBO J. 2023 Jun 15;42(12):e112362. doi: 10.15252/embj.2022112362. Epub 2023 May 8. 10.15252/embj.2022112362 PubMed 37155573
Related items:
Commonly requested with: