pCDH-CMV-RPS15A-3xHA plasmid
(Plasmid
#192245)
-
Purposeoverexpression vector of RPS15A-3XHA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH-CMV-MCS-EF1-puro-3XFLAG-3XHA(XbaI_NotI)
-
Backbone manufacturergenerously provided by L. Wen (Xiamen University)
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPS15A CDS without stop coden
-
SpeciesH. sapiens (human)
-
Insert Size (bp)390
-
Entrez GeneRPS15A (a.k.a. S15a)
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV-F_CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ACC TTC TCT AGG CAC CCG TTC AAT TGC CGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.08.28.505560v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CMV-RPS15A-3xHA plasmid was a gift from Dieter Wolf (Addgene plasmid # 192245 ; http://n2t.net/addgene:192245 ; RRID:Addgene_192245) -
For your References section:
eIF3 mRNA selectivity profiling reveals eIF3k as a cancer-relevant regulator of ribosome content. Duan H, Zhang S, Zarai Y, Ollinger R, Wu Y, Sun L, Hu C, He Y, Tian G, Rad R, Kong X, Cheng Y, Tuller T, Wolf DA. EMBO J. 2023 Jun 15;42(12):e112362. doi: 10.15252/embj.2022112362. Epub 2023 May 8. 10.15252/embj.2022112362 PubMed 37155573