Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSV40_mD6Ertd527e-HA
(Plasmid #192222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSV40
  • Backbone size w/o insert (bp) 2886
  • Total vector size (bp) 4275
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mD6Ertd527e
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1389
  • GenBank ID
    Gene ID: 52372 NR_176826.1
  • Promoter SV40
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EagI,NotI (not destroyed)
  • 5′ sequencing primer cattctccgccccatggctg
  • 3′ sequencing primer AGCAATAGCATCACAAATTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSV40_mD6Ertd527e-HA was a gift from Petr Svoboda (Addgene plasmid # 192222 ; http://n2t.net/addgene:192222 ; RRID:Addgene_192222)
  • For your References section:

    De novo emergence, existence, and demise of a protein-coding gene in murids. Petrzilek J, Pasulka J, Malik R, Horvat F, Kataruka S, Fulka H, Svoboda P. BMC Biol. 2022 Dec 8;20(1):272. doi: 10.1186/s12915-022-01470-5. 10.1186/s12915-022-01470-5 PubMed 36482406