pCon-IFl_Con-IFr
(Plasmid
#192209)
-
PurposeConsensus I-F CRISPR Leader and a CRISPR locus with two consensus I-F repeats, for integration assays.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC57
- Total vector size (bp) 2973
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameConsensus I-F Leader and Consensus I-F Locus DNA
-
SpeciesSynthetic
-
Insert Size (bp)297
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.05.26.542337 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCon-IFl_Con-IFr was a gift from Blake Wiedenheft (Addgene plasmid # 192209 ; http://n2t.net/addgene:192209 ; RRID:Addgene_192209) -
For your References section:
Structure reveals why genome folding is necessary for site-specific integration of foreign DNA into CRISPR arrays. Santiago-Frangos A, Henriques WS, Wiegand T, Gauvin CC, Buyukyoruk M, Graham AB, Wilkinson RA, Triem L, Neselu K, Eng ET, Lander GC, Wiedenheft B. Nat Struct Mol Biol. 2023 Nov;30(11):1675-1685. doi: 10.1038/s41594-023-01097-2. Epub 2023 Sep 14. 10.1038/s41594-023-01097-2 PubMed 37710013