pHR-ON VIPER CAR (anti-CD19)-final design
(Plasmid
#192117)
-
PurposeLentiviral deliviery of ON VIPER CAR (anti-CD19)-final design
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8440
- Total vector size (bp) 12132
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepHR-pEF1a-VIPER CAR (anti-CD19scFV_CD28_NS3_41BB_CD3z)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3692
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-ON VIPER CAR (anti-CD19)-final design was a gift from Wilson Wong (Addgene plasmid # 192117 ; http://n2t.net/addgene:192117 ; RRID:Addgene_192117) -
For your References section:
High-performance multiplex drug-gated CAR circuits. Li HS, Wong NM, Tague E, Ngo JT, Khalil AS, Wong WW. Cancer Cell. 2022 Aug 26. pii: S1535-6108(22)00372-5. doi: 10.1016/j.ccell.2022.08.008. 10.1016/j.ccell.2022.08.008 PubMed 36084652