pLenti-PGK-CXCR4 (neo)
(Plasmid #192077)

• Purpose: Lentivirus for expression of CXCR4
• Depositing Lab: Roland Friedel
• Publication: Lentiviral vectors for functional studies in GBM cells (unpublished)

Backbone

• Vector backbone: pLENTI PGK Neo DEST
• Backbone manufacturer: Eric Campeau & Paul Kaufman (Addgene plasmid # 19067)
• Backbone size w/o insert (bp): 8150
• Vector type: Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CXCR4
• Species: H. sapiens (human)
• Insert Size (bp): 1149
• Entrez Gene: CXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
• Promoter: hPGK

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pL-PGKneo-seqF1 ctcgttgaccgaatcaccga
• 3′ sequencing primer: pL-PGKneo-seqR1 caatagcatgatacaaaggcat

Resource Information

• Supplemental Documents:
  • pLenti-PGK-CXCR4 (neo).gb
• A portion of this plasmid was derived from a plasmid made by: The CXCR4 cDNA was obtained from plasmid pDONR223_CXCR4_WT addgene-plasmid-81957-sequence-169036 via Gateway cloning.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The CXCR4 cDNA encodes a number of undefined amino-acids at its C-terminus, as the cDNA donor plasmid pDONR223_CXCR4_WT does not contain a stop codon.