CAG-BFP-sesRNA-tTA2-WPRE-pA
(Plasmid
#192070)
-
PurposeExpression of BFP, sesRNA in mammalian cells, with tTA2 as efRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Cbh-ADAR2-sesRNA-GFP-W3SL
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesesRNA for tdTom
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctactaacttcagcctgctg
- 3′ sequencing primer gggattctcctccacgtcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-BFP-sesRNA-tTA2-WPRE-pA was a gift from Josh Huang (Addgene plasmid # 192070 ; http://n2t.net/addgene:192070 ; RRID:Addgene_192070) -
For your References section:
Programmable RNA sensing for cell monitoring and manipulation. Qian Y, Li J, Zhao S, Matthews EA, Adoff M, Zhong W, An X, Yeo M, Park C, Yang X, Wang BS, Southwell DG, Huang ZJ. Nature. 2022 Oct;610(7933):713-721. doi: 10.1038/s41586-022-05280-1. Epub 2022 Oct 5. 10.1038/s41586-022-05280-1 PubMed 36198803