Skip to main content
Addgene

CAG-mCherry-sesRNA-GFP-WPRE-pA
(Plasmid #192065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192065 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CAG-BFP-sesRNA-GFP-WPRE-pA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sesRNA for Cheta
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctactaacttcagcctgctg
  • 3′ sequencing primer agggccgggattctcctcca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-mCherry-sesRNA-GFP-WPRE-pA was a gift from Josh Huang (Addgene plasmid # 192065 ; http://n2t.net/addgene:192065 ; RRID:Addgene_192065)
  • For your References section:

    Programmable RNA sensing for cell monitoring and manipulation. Qian Y, Li J, Zhao S, Matthews EA, Adoff M, Zhong W, An X, Yeo M, Park C, Yang X, Wang BS, Southwell DG, Huang ZJ. Nature. 2022 Oct;610(7933):713-721. doi: 10.1038/s41586-022-05280-1. Epub 2022 Oct 5. 10.1038/s41586-022-05280-1 PubMed 36198803