pFastBac SOX Q129H
(Plasmid
#192057)
-
PurposeExpression vector for SOX (ORF37) Q129H
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5499
- Total vector size (bp) 6957
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSOX (ORF37) Q129H
-
Alt nameORF37 Q129H
-
SpeciesSynthetic
-
Insert Size (bp)1461
-
MutationQ129H
- Promoter Polyhedrin
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac SOX Q129H was a gift from Britt Glaunsinger (Addgene plasmid # 192057 ; http://n2t.net/addgene:192057 ; RRID:Addgene_192057) -
For your References section:
DNA processing by the Kaposi's sarcoma-associated herpesvirus alkaline exonuclease SOX contributes to viral gene expression and infectious virion production. Hartenian E, Mendez AS, Didychuk AL, Khosla S, Glaunsinger BA. Nucleic Acids Res. 2023 Jan 11;51(1):182-197. doi: 10.1093/nar/gkac1190. 10.1093/nar/gkac1190 PubMed 36537232